Virus:Article Title: Broad cross-reactivity across sarbecoviruses exhibited by a subset of COVID-19 donor-derived neutralizing antibodies
Article Snippet: .. 1126/science.abf6840 SARS-CoV-2 B.1.1.7 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.351 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.429 pseudotyped reporter virus Bjorkman lab (this paper) N/A SARS-CoV-2 B.1.526 pseudotyped reporter virus Bjorkman lab (this paper) N/A E. coli DH5 Alpha Zymo Research Cat# T3009 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) GIBCO Cat# 11960-044 Fetal bovine serum (FBS) Sigma-Aldrich Cat# F4135 Gentamicin solution Sigma-Aldrich Cat# G1397 CAS:1405-41-0 Blasticidin S HCl GIBCO Cat# A1113902 CAS:3513-03-9 Expi293 Expression Medium GIBCO Cat# A1435102 Expi293 Expression System Kit GIBCO Cat# A14635 LB Broth (Miller) Sigma-Aldrich Cat# L3522 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific Cat# 34029 HBS-EP+ Buffer 20x Teknova Cat# H8022 Critical commercial assays Luciferase Cell Culture Lysis 5X Reagent Promega Cat# E1531 Nano-Glo Luciferase Assay System Promega Cat# N1110 Deposited data C118 Fab/SARS-CoV-2 S 2P state 1 coordinates This paper PDB: 7RKV C118 Fab/SARS-CoV-2 S 2P state 1 CryoEM map This paper EMDB: 24504 C118 Fab/SARS-CoV-2 S 2P state 2 CryoEM map This paper EMDB: 24505 C118 Fab/SARS-CoV RBD crystal structure This paper PDB: 7RKS C022 Fab/SARS-CoV-2 RBD crystal structure This paper PDB: 7RKU (Continued on next page) e1 Cell Reports 36, 109760, September 28, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HEK293T cells Pear et al., 1993 Cat# CCLV-RIE 1018 RRID:CVCL_0063 HEK293TAce2 cells BEI Cat# NR-52511 Expi293F cells GIBCO Cat# A14527 RRID:CVCL_D615 Recombinant DNA SARS-CoV-2 S (residues 16-1206) Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank: MN985325.1 SARS-CoV2-Strunc B.1.429 Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank QQM19141 residues 1-1252 pTwist-CMV BetaGlobin-SARS-CoV-2 S RBD (residues 331-524) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 pTwist-CMV BetaGlobin-SARS-CoV S RBD (residues 318-510) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 CR3022 Fab HC, CR3022 IgG HC, CR3022 LC Yuan et al., 2020b https://www.science.org/lookup/doi/10.
Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD26-PE-Cy7 Biolegend 302713; RRID: AB_2563992 CD13-BV785 Biolegend 301725; RRID: AB_2734250 Goat anti-Human IgG-Fc Fragment Antibody Bethyl A80-104A; RRID: AB_67061 RBD812 Antibody This paper N/A S2P6 Antibody This paper N/A 76E1 Antibody This paper N/A Bacterial and virus strains DH5α Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USB TM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G Stem Helix Peptide SARS-CoV-2 Genscript N/A Fusion Peptide SARS-CoV-2 Genscript N/A RBD Obtained from the lab of Dr. Aaron Schmidt N/A SARS-CoV-2 Spike Obtained from the lab of Dr. Aaron Schmidt N/A PureCube Maleimide Activated MagBeads Cube Biotech Cat# 51201 Dynabeads TM His-Tag Isolation and Pulldown Thermofisher Cat# 10103D Critical Commercial Reagents In-Fusion HD Cloning Kit Takara 639650 TMB 2-Component Microwell Peroxidase Substrate Kit VWR 95059–156 Dynabeads Thermofisher 10103D Maleimide activated beads Cube Biotech 51201 In-Fusion HD Cloning Kit Takara 639650 Experimental models: cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) 12 Cell Reports 45, 116954, February 24, 2026 ..
Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS
Article Title: mRNA-based COVID-19 vaccine boosters induce neutralizing immunity against SARS-CoV-2 Omicron variant.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Human ACE-2 Alexa Fluor 647-conjugated Antibody R&D FAB9332R-100G; Lot #: 1580709 Bacterial and virus strains SARS-CoV-2 pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 (wild type) pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.617.2 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.351 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 P.1 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A DH5a Zymo-Competent E. Coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc. Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton-X100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo Dnase Fisher Cat# AM2239 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) Cell 185, 457–466.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Lentivirus LTR qPCR Probe /56-FAM/ AGC+C/i5NitInd/GG+GA/ZEN/GCTCT CTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCT CTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTAT TGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Cat# 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Cat# 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Cat# 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Cat# 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Cat# 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Cat# 179906 pHDM-Hgpm2 (Gag-Pol) This study Addgene Cat# 164441 pHDM-Tat1b (helper) This study Addgene Cat# 164442 pRC-CMV-Rev1b (helper) This study Addgene Cat# 164443 Software and algorithms GraphPad Prism 9.1.2 Graphpad Software www.graphpad.com/scientific-software/ prism/; RRID:SCR_002798 Geneious Prime 2021 Geneious http://www.geneious.com/; RRID:SCR_010519 JMP Pro 15 SAS Institute http://www.jmp.com/en_us/software/jmp. html; RRID:SCR_014242 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automation-workstation? p=tab–4 R v4.0.2 Open source software https://cran.r-project.org/bin/windows/ base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/ home/global/forms/ quantstudio-12k-flex-software-download. html
Recombinant:Article Title: Broad cross-reactivity across sarbecoviruses exhibited by a subset of COVID-19 donor-derived neutralizing antibodies
Article Snippet: .. 1126/science.abf6840 SARS-CoV-2 B.1.1.7 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.351 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.429 pseudotyped reporter virus Bjorkman lab (this paper) N/A SARS-CoV-2 B.1.526 pseudotyped reporter virus Bjorkman lab (this paper) N/A E. coli DH5 Alpha Zymo Research Cat# T3009 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) GIBCO Cat# 11960-044 Fetal bovine serum (FBS) Sigma-Aldrich Cat# F4135 Gentamicin solution Sigma-Aldrich Cat# G1397 CAS:1405-41-0 Blasticidin S HCl GIBCO Cat# A1113902 CAS:3513-03-9 Expi293 Expression Medium GIBCO Cat# A1435102 Expi293 Expression System Kit GIBCO Cat# A14635 LB Broth (Miller) Sigma-Aldrich Cat# L3522 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific Cat# 34029 HBS-EP+ Buffer 20x Teknova Cat# H8022 Critical commercial assays Luciferase Cell Culture Lysis 5X Reagent Promega Cat# E1531 Nano-Glo Luciferase Assay System Promega Cat# N1110 Deposited data C118 Fab/SARS-CoV-2 S 2P state 1 coordinates This paper PDB: 7RKV C118 Fab/SARS-CoV-2 S 2P state 1 CryoEM map This paper EMDB: 24504 C118 Fab/SARS-CoV-2 S 2P state 2 CryoEM map This paper EMDB: 24505 C118 Fab/SARS-CoV RBD crystal structure This paper PDB: 7RKS C022 Fab/SARS-CoV-2 RBD crystal structure This paper PDB: 7RKU (Continued on next page) e1 Cell Reports 36, 109760, September 28, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HEK293T cells Pear et al., 1993 Cat# CCLV-RIE 1018 RRID:CVCL_0063 HEK293TAce2 cells BEI Cat# NR-52511 Expi293F cells GIBCO Cat# A14527 RRID:CVCL_D615 Recombinant DNA SARS-CoV-2 S (residues 16-1206) Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank: MN985325.1 SARS-CoV2-Strunc B.1.429 Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank QQM19141 residues 1-1252 pTwist-CMV BetaGlobin-SARS-CoV-2 S RBD (residues 331-524) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 pTwist-CMV BetaGlobin-SARS-CoV S RBD (residues 318-510) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 CR3022 Fab HC, CR3022 IgG HC, CR3022 LC Yuan et al., 2020b https://www.science.org/lookup/doi/10.
Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD26-PE-Cy7 Biolegend 302713; RRID: AB_2563992 CD13-BV785 Biolegend 301725; RRID: AB_2734250 Goat anti-Human IgG-Fc Fragment Antibody Bethyl A80-104A; RRID: AB_67061 RBD812 Antibody This paper N/A S2P6 Antibody This paper N/A 76E1 Antibody This paper N/A Bacterial and virus strains DH5α Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USB TM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G Stem Helix Peptide SARS-CoV-2 Genscript N/A Fusion Peptide SARS-CoV-2 Genscript N/A RBD Obtained from the lab of Dr. Aaron Schmidt N/A SARS-CoV-2 Spike Obtained from the lab of Dr. Aaron Schmidt N/A PureCube Maleimide Activated MagBeads Cube Biotech Cat# 51201 Dynabeads TM His-Tag Isolation and Pulldown Thermofisher Cat# 10103D Critical Commercial Reagents In-Fusion HD Cloning Kit Takara 639650 TMB 2-Component Microwell Peroxidase Substrate Kit VWR 95059–156 Dynabeads Thermofisher 10103D Maleimide activated beads Cube Biotech 51201 In-Fusion HD Cloning Kit Takara 639650 Experimental models: cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) 12 Cell Reports 45, 116954, February 24, 2026 ..
Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS
Article Title: mRNA-based COVID-19 vaccine boosters induce neutralizing immunity against SARS-CoV-2 Omicron variant.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Human ACE-2 Alexa Fluor 647-conjugated Antibody R&D FAB9332R-100G; Lot #: 1580709 Bacterial and virus strains SARS-CoV-2 pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 (wild type) pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.617.2 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.351 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 P.1 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A DH5a Zymo-Competent E. Coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc. Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton-X100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo Dnase Fisher Cat# AM2239 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) Cell 185, 457–466.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Lentivirus LTR qPCR Probe /56-FAM/ AGC+C/i5NitInd/GG+GA/ZEN/GCTCT CTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCT CTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTAT TGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Cat# 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Cat# 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Cat# 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Cat# 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Cat# 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Cat# 179906 pHDM-Hgpm2 (Gag-Pol) This study Addgene Cat# 164441 pHDM-Tat1b (helper) This study Addgene Cat# 164442 pRC-CMV-Rev1b (helper) This study Addgene Cat# 164443 Software and algorithms GraphPad Prism 9.1.2 Graphpad Software www.graphpad.com/scientific-software/ prism/; RRID:SCR_002798 Geneious Prime 2021 Geneious http://www.geneious.com/; RRID:SCR_010519 JMP Pro 15 SAS Institute http://www.jmp.com/en_us/software/jmp. html; RRID:SCR_014242 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automation-workstation? p=tab–4 R v4.0.2 Open source software https://cran.r-project.org/bin/windows/ base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/ home/global/forms/ quantstudio-12k-flex-software-download. html
Modification:Article Title: Broad cross-reactivity across sarbecoviruses exhibited by a subset of COVID-19 donor-derived neutralizing antibodies
Article Snippet: .. 1126/science.abf6840 SARS-CoV-2 B.1.1.7 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.351 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.429 pseudotyped reporter virus Bjorkman lab (this paper) N/A SARS-CoV-2 B.1.526 pseudotyped reporter virus Bjorkman lab (this paper) N/A E. coli DH5 Alpha Zymo Research Cat# T3009 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) GIBCO Cat# 11960-044 Fetal bovine serum (FBS) Sigma-Aldrich Cat# F4135 Gentamicin solution Sigma-Aldrich Cat# G1397 CAS:1405-41-0 Blasticidin S HCl GIBCO Cat# A1113902 CAS:3513-03-9 Expi293 Expression Medium GIBCO Cat# A1435102 Expi293 Expression System Kit GIBCO Cat# A14635 LB Broth (Miller) Sigma-Aldrich Cat# L3522 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific Cat# 34029 HBS-EP+ Buffer 20x Teknova Cat# H8022 Critical commercial assays Luciferase Cell Culture Lysis 5X Reagent Promega Cat# E1531 Nano-Glo Luciferase Assay System Promega Cat# N1110 Deposited data C118 Fab/SARS-CoV-2 S 2P state 1 coordinates This paper PDB: 7RKV C118 Fab/SARS-CoV-2 S 2P state 1 CryoEM map This paper EMDB: 24504 C118 Fab/SARS-CoV-2 S 2P state 2 CryoEM map This paper EMDB: 24505 C118 Fab/SARS-CoV RBD crystal structure This paper PDB: 7RKS C022 Fab/SARS-CoV-2 RBD crystal structure This paper PDB: 7RKU (Continued on next page) e1 Cell Reports 36, 109760, September 28, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HEK293T cells Pear et al., 1993 Cat# CCLV-RIE 1018 RRID:CVCL_0063 HEK293TAce2 cells BEI Cat# NR-52511 Expi293F cells GIBCO Cat# A14527 RRID:CVCL_D615 Recombinant DNA SARS-CoV-2 S (residues 16-1206) Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank: MN985325.1 SARS-CoV2-Strunc B.1.429 Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank QQM19141 residues 1-1252 pTwist-CMV BetaGlobin-SARS-CoV-2 S RBD (residues 331-524) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 pTwist-CMV BetaGlobin-SARS-CoV S RBD (residues 318-510) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 CR3022 Fab HC, CR3022 IgG HC, CR3022 LC Yuan et al., 2020b https://www.science.org/lookup/doi/10.
Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD26-PE-Cy7 Biolegend 302713; RRID: AB_2563992 CD13-BV785 Biolegend 301725; RRID: AB_2734250 Goat anti-Human IgG-Fc Fragment Antibody Bethyl A80-104A; RRID: AB_67061 RBD812 Antibody This paper N/A S2P6 Antibody This paper N/A 76E1 Antibody This paper N/A Bacterial and virus strains DH5α Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USB TM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G Stem Helix Peptide SARS-CoV-2 Genscript N/A Fusion Peptide SARS-CoV-2 Genscript N/A RBD Obtained from the lab of Dr. Aaron Schmidt N/A SARS-CoV-2 Spike Obtained from the lab of Dr. Aaron Schmidt N/A PureCube Maleimide Activated MagBeads Cube Biotech Cat# 51201 Dynabeads TM His-Tag Isolation and Pulldown Thermofisher Cat# 10103D Critical Commercial Reagents In-Fusion HD Cloning Kit Takara 639650 TMB 2-Component Microwell Peroxidase Substrate Kit VWR 95059–156 Dynabeads Thermofisher 10103D Maleimide activated beads Cube Biotech 51201 In-Fusion HD Cloning Kit Takara 639650 Experimental models: cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) 12 Cell Reports 45, 116954, February 24, 2026 ..
Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS
Article Title: mRNA-based COVID-19 vaccine boosters induce neutralizing immunity against SARS-CoV-2 Omicron variant.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Human ACE-2 Alexa Fluor 647-conjugated Antibody R&D FAB9332R-100G; Lot #: 1580709 Bacterial and virus strains SARS-CoV-2 pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 (wild type) pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.617.2 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.351 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 P.1 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A DH5a Zymo-Competent E. Coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc. Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton-X100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo Dnase Fisher Cat# AM2239 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) Cell 185, 457–466.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Lentivirus LTR qPCR Probe /56-FAM/ AGC+C/i5NitInd/GG+GA/ZEN/GCTCT CTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCT CTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTAT TGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Cat# 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Cat# 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Cat# 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Cat# 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Cat# 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Cat# 179906 pHDM-Hgpm2 (Gag-Pol) This study Addgene Cat# 164441 pHDM-Tat1b (helper) This study Addgene Cat# 164442 pRC-CMV-Rev1b (helper) This study Addgene Cat# 164443 Software and algorithms GraphPad Prism 9.1.2 Graphpad Software www.graphpad.com/scientific-software/ prism/; RRID:SCR_002798 Geneious Prime 2021 Geneious http://www.geneious.com/; RRID:SCR_010519 JMP Pro 15 SAS Institute http://www.jmp.com/en_us/software/jmp. html; RRID:SCR_014242 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automation-workstation? p=tab–4 R v4.0.2 Open source software https://cran.r-project.org/bin/windows/ base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/ home/global/forms/ quantstudio-12k-flex-software-download. html
Expressing:Article Title: Broad cross-reactivity across sarbecoviruses exhibited by a subset of COVID-19 donor-derived neutralizing antibodies
Article Snippet: .. 1126/science.abf6840 SARS-CoV-2 B.1.1.7 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.351 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.429 pseudotyped reporter virus Bjorkman lab (this paper) N/A SARS-CoV-2 B.1.526 pseudotyped reporter virus Bjorkman lab (this paper) N/A E. coli DH5 Alpha Zymo Research Cat# T3009 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) GIBCO Cat# 11960-044 Fetal bovine serum (FBS) Sigma-Aldrich Cat# F4135 Gentamicin solution Sigma-Aldrich Cat# G1397 CAS:1405-41-0 Blasticidin S HCl GIBCO Cat# A1113902 CAS:3513-03-9 Expi293 Expression Medium GIBCO Cat# A1435102 Expi293 Expression System Kit GIBCO Cat# A14635 LB Broth (Miller) Sigma-Aldrich Cat# L3522 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific Cat# 34029 HBS-EP+ Buffer 20x Teknova Cat# H8022 Critical commercial assays Luciferase Cell Culture Lysis 5X Reagent Promega Cat# E1531 Nano-Glo Luciferase Assay System Promega Cat# N1110 Deposited data C118 Fab/SARS-CoV-2 S 2P state 1 coordinates This paper PDB: 7RKV C118 Fab/SARS-CoV-2 S 2P state 1 CryoEM map This paper EMDB: 24504 C118 Fab/SARS-CoV-2 S 2P state 2 CryoEM map This paper EMDB: 24505 C118 Fab/SARS-CoV RBD crystal structure This paper PDB: 7RKS C022 Fab/SARS-CoV-2 RBD crystal structure This paper PDB: 7RKU (Continued on next page) e1 Cell Reports 36, 109760, September 28, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HEK293T cells Pear et al., 1993 Cat# CCLV-RIE 1018 RRID:CVCL_0063 HEK293TAce2 cells BEI Cat# NR-52511 Expi293F cells GIBCO Cat# A14527 RRID:CVCL_D615 Recombinant DNA SARS-CoV-2 S (residues 16-1206) Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank: MN985325.1 SARS-CoV2-Strunc B.1.429 Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank QQM19141 residues 1-1252 pTwist-CMV BetaGlobin-SARS-CoV-2 S RBD (residues 331-524) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 pTwist-CMV BetaGlobin-SARS-CoV S RBD (residues 318-510) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 CR3022 Fab HC, CR3022 IgG HC, CR3022 LC Yuan et al., 2020b https://www.science.org/lookup/doi/10.
Luciferase:Article Title: Broad cross-reactivity across sarbecoviruses exhibited by a subset of COVID-19 donor-derived neutralizing antibodies
Article Snippet: .. 1126/science.abf6840 SARS-CoV-2 B.1.1.7 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.351 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.429 pseudotyped reporter virus Bjorkman lab (this paper) N/A SARS-CoV-2 B.1.526 pseudotyped reporter virus Bjorkman lab (this paper) N/A E. coli DH5 Alpha Zymo Research Cat# T3009 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) GIBCO Cat# 11960-044 Fetal bovine serum (FBS) Sigma-Aldrich Cat# F4135 Gentamicin solution Sigma-Aldrich Cat# G1397 CAS:1405-41-0 Blasticidin S HCl GIBCO Cat# A1113902 CAS:3513-03-9 Expi293 Expression Medium GIBCO Cat# A1435102 Expi293 Expression System Kit GIBCO Cat# A14635 LB Broth (Miller) Sigma-Aldrich Cat# L3522 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific Cat# 34029 HBS-EP+ Buffer 20x Teknova Cat# H8022 Critical commercial assays Luciferase Cell Culture Lysis 5X Reagent Promega Cat# E1531 Nano-Glo Luciferase Assay System Promega Cat# N1110 Deposited data C118 Fab/SARS-CoV-2 S 2P state 1 coordinates This paper PDB: 7RKV C118 Fab/SARS-CoV-2 S 2P state 1 CryoEM map This paper EMDB: 24504 C118 Fab/SARS-CoV-2 S 2P state 2 CryoEM map This paper EMDB: 24505 C118 Fab/SARS-CoV RBD crystal structure This paper PDB: 7RKS C022 Fab/SARS-CoV-2 RBD crystal structure This paper PDB: 7RKU (Continued on next page) e1 Cell Reports 36, 109760, September 28, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HEK293T cells Pear et al., 1993 Cat# CCLV-RIE 1018 RRID:CVCL_0063 HEK293TAce2 cells BEI Cat# NR-52511 Expi293F cells GIBCO Cat# A14527 RRID:CVCL_D615 Recombinant DNA SARS-CoV-2 S (residues 16-1206) Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank: MN985325.1 SARS-CoV2-Strunc B.1.429 Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank QQM19141 residues 1-1252 pTwist-CMV BetaGlobin-SARS-CoV-2 S RBD (residues 331-524) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 pTwist-CMV BetaGlobin-SARS-CoV S RBD (residues 318-510) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 CR3022 Fab HC, CR3022 IgG HC, CR3022 LC Yuan et al., 2020b https://www.science.org/lookup/doi/10.
Cell Culture:Article Title: Broad cross-reactivity across sarbecoviruses exhibited by a subset of COVID-19 donor-derived neutralizing antibodies
Article Snippet: .. 1126/science.abf6840 SARS-CoV-2 B.1.1.7 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.351 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.429 pseudotyped reporter virus Bjorkman lab (this paper) N/A SARS-CoV-2 B.1.526 pseudotyped reporter virus Bjorkman lab (this paper) N/A E. coli DH5 Alpha Zymo Research Cat# T3009 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) GIBCO Cat# 11960-044 Fetal bovine serum (FBS) Sigma-Aldrich Cat# F4135 Gentamicin solution Sigma-Aldrich Cat# G1397 CAS:1405-41-0 Blasticidin S HCl GIBCO Cat# A1113902 CAS:3513-03-9 Expi293 Expression Medium GIBCO Cat# A1435102 Expi293 Expression System Kit GIBCO Cat# A14635 LB Broth (Miller) Sigma-Aldrich Cat# L3522 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific Cat# 34029 HBS-EP+ Buffer 20x Teknova Cat# H8022 Critical commercial assays Luciferase Cell Culture Lysis 5X Reagent Promega Cat# E1531 Nano-Glo Luciferase Assay System Promega Cat# N1110 Deposited data C118 Fab/SARS-CoV-2 S 2P state 1 coordinates This paper PDB: 7RKV C118 Fab/SARS-CoV-2 S 2P state 1 CryoEM map This paper EMDB: 24504 C118 Fab/SARS-CoV-2 S 2P state 2 CryoEM map This paper EMDB: 24505 C118 Fab/SARS-CoV RBD crystal structure This paper PDB: 7RKS C022 Fab/SARS-CoV-2 RBD crystal structure This paper PDB: 7RKU (Continued on next page) e1 Cell Reports 36, 109760, September 28, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HEK293T cells Pear et al., 1993 Cat# CCLV-RIE 1018 RRID:CVCL_0063 HEK293TAce2 cells BEI Cat# NR-52511 Expi293F cells GIBCO Cat# A14527 RRID:CVCL_D615 Recombinant DNA SARS-CoV-2 S (residues 16-1206) Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank: MN985325.1 SARS-CoV2-Strunc B.1.429 Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank QQM19141 residues 1-1252 pTwist-CMV BetaGlobin-SARS-CoV-2 S RBD (residues 331-524) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 pTwist-CMV BetaGlobin-SARS-CoV S RBD (residues 318-510) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 CR3022 Fab HC, CR3022 IgG HC, CR3022 LC Yuan et al., 2020b https://www.science.org/lookup/doi/10.
Lysis:Article Title: Broad cross-reactivity across sarbecoviruses exhibited by a subset of COVID-19 donor-derived neutralizing antibodies
Article Snippet: .. 1126/science.abf6840 SARS-CoV-2 B.1.1.7 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.351 pseudotyped reporter virus Scheid et al., 2021 https://linkinghub.elsevier.com/retrieve/pii/ S0092867421005353 SARS-CoV-2 B.1.429 pseudotyped reporter virus Bjorkman lab (this paper) N/A SARS-CoV-2 B.1.526 pseudotyped reporter virus Bjorkman lab (this paper) N/A E. coli DH5 Alpha Zymo Research Cat# T3009 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) GIBCO Cat# 11960-044 Fetal bovine serum (FBS) Sigma-Aldrich Cat# F4135 Gentamicin solution Sigma-Aldrich Cat# G1397 CAS:1405-41-0 Blasticidin S HCl GIBCO Cat# A1113902 CAS:3513-03-9 Expi293 Expression Medium GIBCO Cat# A1435102 Expi293 Expression System Kit GIBCO Cat# A14635 LB Broth (Miller) Sigma-Aldrich Cat# L3522 1-Step Ultra TMB-ELISA Substrate Solution Thermo Scientific Cat# 34029 HBS-EP+ Buffer 20x Teknova Cat# H8022 Critical commercial assays Luciferase Cell Culture Lysis 5X Reagent Promega Cat# E1531 Nano-Glo Luciferase Assay System Promega Cat# N1110 Deposited data C118 Fab/SARS-CoV-2 S 2P state 1 coordinates This paper PDB: 7RKV C118 Fab/SARS-CoV-2 S 2P state 1 CryoEM map This paper EMDB: 24504 C118 Fab/SARS-CoV-2 S 2P state 2 CryoEM map This paper EMDB: 24505 C118 Fab/SARS-CoV RBD crystal structure This paper PDB: 7RKS C022 Fab/SARS-CoV-2 RBD crystal structure This paper PDB: 7RKU (Continued on next page) e1 Cell Reports 36, 109760, September 28, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HEK293T cells Pear et al., 1993 Cat# CCLV-RIE 1018 RRID:CVCL_0063 HEK293TAce2 cells BEI Cat# NR-52511 Expi293F cells GIBCO Cat# A14527 RRID:CVCL_D615 Recombinant DNA SARS-CoV-2 S (residues 16-1206) Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank: MN985325.1 SARS-CoV2-Strunc B.1.429 Pamela J. Bjorkman, California Institute of Technology (This paper) GenBank QQM19141 residues 1-1252 pTwist-CMV BetaGlobin-SARS-CoV-2 S RBD (residues 331-524) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 pTwist-CMV BetaGlobin-SARS-CoV S RBD (residues 318-510) Barnes et al., 2020b https://linkinghub.elsevier.com/retrieve/pii/ S0092867420307571 CR3022 Fab HC, CR3022 IgG HC, CR3022 LC Yuan et al., 2020b https://www.science.org/lookup/doi/10.
Saline:Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD26-PE-Cy7 Biolegend 302713; RRID: AB_2563992 CD13-BV785 Biolegend 301725; RRID: AB_2734250 Goat anti-Human IgG-Fc Fragment Antibody Bethyl A80-104A; RRID: AB_67061 RBD812 Antibody This paper N/A S2P6 Antibody This paper N/A 76E1 Antibody This paper N/A Bacterial and virus strains DH5α Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USB TM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G Stem Helix Peptide SARS-CoV-2 Genscript N/A Fusion Peptide SARS-CoV-2 Genscript N/A RBD Obtained from the lab of Dr. Aaron Schmidt N/A SARS-CoV-2 Spike Obtained from the lab of Dr. Aaron Schmidt N/A PureCube Maleimide Activated MagBeads Cube Biotech Cat# 51201 Dynabeads TM His-Tag Isolation and Pulldown Thermofisher Cat# 10103D Critical Commercial Reagents In-Fusion HD Cloning Kit Takara 639650 TMB 2-Component Microwell Peroxidase Substrate Kit VWR 95059–156 Dynabeads Thermofisher 10103D Maleimide activated beads Cube Biotech 51201 In-Fusion HD Cloning Kit Takara 639650 Experimental models: cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) 12 Cell Reports 45, 116954, February 24, 2026 ..
Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS
Article Title: mRNA-based COVID-19 vaccine boosters induce neutralizing immunity against SARS-CoV-2 Omicron variant.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Human ACE-2 Alexa Fluor 647-conjugated Antibody R&D FAB9332R-100G; Lot #: 1580709 Bacterial and virus strains SARS-CoV-2 pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 (wild type) pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.617.2 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.351 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 P.1 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A DH5a Zymo-Competent E. Coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc. Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton-X100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo Dnase Fisher Cat# AM2239 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) Cell 185, 457–466.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Lentivirus LTR qPCR Probe /56-FAM/ AGC+C/i5NitInd/GG+GA/ZEN/GCTCT CTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCT CTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTAT TGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Cat# 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Cat# 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Cat# 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Cat# 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Cat# 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Cat# 179906 pHDM-Hgpm2 (Gag-Pol) This study Addgene Cat# 164441 pHDM-Tat1b (helper) This study Addgene Cat# 164442 pRC-CMV-Rev1b (helper) This study Addgene Cat# 164443 Software and algorithms GraphPad Prism 9.1.2 Graphpad Software www.graphpad.com/scientific-software/ prism/; RRID:SCR_002798 Geneious Prime 2021 Geneious http://www.geneious.com/; RRID:SCR_010519 JMP Pro 15 SAS Institute http://www.jmp.com/en_us/software/jmp. html; RRID:SCR_014242 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automation-workstation? p=tab–4 R v4.0.2 Open source software https://cran.r-project.org/bin/windows/ base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/ home/global/forms/ quantstudio-12k-flex-software-download. html
Isolation:Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD26-PE-Cy7 Biolegend 302713; RRID: AB_2563992 CD13-BV785 Biolegend 301725; RRID: AB_2734250 Goat anti-Human IgG-Fc Fragment Antibody Bethyl A80-104A; RRID: AB_67061 RBD812 Antibody This paper N/A S2P6 Antibody This paper N/A 76E1 Antibody This paper N/A Bacterial and virus strains DH5α Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USB TM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G Stem Helix Peptide SARS-CoV-2 Genscript N/A Fusion Peptide SARS-CoV-2 Genscript N/A RBD Obtained from the lab of Dr. Aaron Schmidt N/A SARS-CoV-2 Spike Obtained from the lab of Dr. Aaron Schmidt N/A PureCube Maleimide Activated MagBeads Cube Biotech Cat# 51201 Dynabeads TM His-Tag Isolation and Pulldown Thermofisher Cat# 10103D Critical Commercial Reagents In-Fusion HD Cloning Kit Takara 639650 TMB 2-Component Microwell Peroxidase Substrate Kit VWR 95059–156 Dynabeads Thermofisher 10103D Maleimide activated beads Cube Biotech 51201 In-Fusion HD Cloning Kit Takara 639650 Experimental models: cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) 12 Cell Reports 45, 116954, February 24, 2026 ..
Cloning:Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD26-PE-Cy7 Biolegend 302713; RRID: AB_2563992 CD13-BV785 Biolegend 301725; RRID: AB_2734250 Goat anti-Human IgG-Fc Fragment Antibody Bethyl A80-104A; RRID: AB_67061 RBD812 Antibody This paper N/A S2P6 Antibody This paper N/A 76E1 Antibody This paper N/A Bacterial and virus strains DH5α Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USB TM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G Stem Helix Peptide SARS-CoV-2 Genscript N/A Fusion Peptide SARS-CoV-2 Genscript N/A RBD Obtained from the lab of Dr. Aaron Schmidt N/A SARS-CoV-2 Spike Obtained from the lab of Dr. Aaron Schmidt N/A PureCube Maleimide Activated MagBeads Cube Biotech Cat# 51201 Dynabeads TM His-Tag Isolation and Pulldown Thermofisher Cat# 10103D Critical Commercial Reagents In-Fusion HD Cloning Kit Takara 639650 TMB 2-Component Microwell Peroxidase Substrate Kit VWR 95059–156 Dynabeads Thermofisher 10103D Maleimide activated beads Cube Biotech 51201 In-Fusion HD Cloning Kit Takara 639650 Experimental models: cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) 12 Cell Reports 45, 116954, February 24, 2026 ..
Quantitative RT-PCR:Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS
Article Title: mRNA-based COVID-19 vaccine boosters induce neutralizing immunity against SARS-CoV-2 Omicron variant.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Human ACE-2 Alexa Fluor 647-conjugated Antibody R&D FAB9332R-100G; Lot #: 1580709 Bacterial and virus strains SARS-CoV-2 pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 (wild type) pseudotyped pHAGE-CMV-Luc2-IRESZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.617.2 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 B.1.351 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A SARS-CoV-2 DC18 P.1 pseudotyped pHAGE-CMV-Luc2-IRES-ZsGreen-W lentivirus This study N/A DH5a Zymo-Competent E. Coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc. Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton-X100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo Dnase Fisher Cat# AM2239 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A (Continued on next page) Cell 185, 457–466.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Lentivirus LTR qPCR Probe /56-FAM/ AGC+C/i5NitInd/GG+GA/ZEN/GCTCT CTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCT CTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTAT TGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Cat# 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Cat# 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Cat# 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Cat# 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Cat# 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Cat# 179906 pHDM-Hgpm2 (Gag-Pol) This study Addgene Cat# 164441 pHDM-Tat1b (helper) This study Addgene Cat# 164442 pRC-CMV-Rev1b (helper) This study Addgene Cat# 164443 Software and algorithms GraphPad Prism 9.1.2 Graphpad Software www.graphpad.com/scientific-software/ prism/; RRID:SCR_002798 Geneious Prime 2021 Geneious http://www.geneious.com/; RRID:SCR_010519 JMP Pro 15 SAS Institute http://www.jmp.com/en_us/software/jmp. html; RRID:SCR_014242 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automation-workstation? p=tab–4 R v4.0.2 Open source software https://cran.r-project.org/bin/windows/ base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/ home/global/forms/ quantstudio-12k-flex-software-download. html
Real-time Polymerase Chain Reaction:Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS
Plasmid Preparation:Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS
|
Zymo Research is a verified supplier 
Zymo Research manufactures this product 